Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E548878

Search information 
Request: 548878Match: SGN-E548878
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192301Clone name: TUS-65-E3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C95119 [cLEX-8-K2] Trace: SGN-T115957 EST: SGN-E301430 Direction: 5' Facility: TIGR
Clone: SGN-C192301 [TUS-65-E3] Trace: SGN-T344314 EST: SGN-E543439 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E548878Length: 330 bp (863 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E548878 [] (trimmed) GATGAAAACATACTGGCTTTGGTAATACAAATTAGTTGTTGTATAACATCTCAAACCATCATGGACTGGTTCAAGGCTCAAGGCCTTGCATGTCA
TTGGCAAGTTTTAAAAAATAAATGCCTAATACAGTTAGCCCTTGTAACTAGGATAAAAGATTGCAGGCTGGTTTCAGTCAAAAGAAATGCTGATC
TATAACTCTTATCCACTTACTTTACAATAGGAGGCTGAGCTAATTGTTGTAGCTGATGGACGACGTGTGACATCCTCGGACGCATTGATGGTACA
TGTTGTGTACAAGAATAAACAAGATCAACAACTTTTTGGATGACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E548878] SGN-U566752 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T349753 [Download][View] Facility Assigned ID: TUS65E03_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0013 Quality Trim Threshold: 14.5