EST details — SGN-E548893

Search information 
Request: 548893Match: SGN-E548893
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192353Clone name: TUS-65-G7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C92231 [cLEX-10-J12] Trace: SGN-T116754 EST: SGN-E304980 Direction: 5' Facility: TIGR
Clone: SGN-C192353 [TUS-65-G7] Trace: SGN-T344403 EST: SGN-E543528 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E548893Length: 362 bp (857 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E548893 [] (trimmed) GAGAAGATCCCTGTAACCCTTTGTTTTTGAGGAATTATGCTCAACTTTTGCAGTTGCTTAGAAATGCTTTATTTATAAGCCGAGGGTCTAGCGGA
AACAACCTCTCTATCTCTATGAGATAAAGGAAAGTCTAAGGGAGATCTTCCTGGAGCTGAACACTATTACTTTCAAGCTACACTAGCTGATCCAA
AAGATGGAGATACCTTGTCACAGTATGCTAAGTTAGTATGGGAGCTGCACCAAGATAAAGATAGAGCATCAGATTACTTTGAACGTGCAGTACGT
ACTGCTCCTGAGAACAGCCATGTTCTTGGAGCATATGCTAGTTTCCTCTGGGACATTACTGACGATGAAAGTGAGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E548893] SGN-U573050 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T349768 [Download][View] Facility Assigned ID: TUS65G07_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0014 Quality Trim Threshold: 14.5