EST details — SGN-E549156

Search information 
Request: 549156Match: SGN-E549156
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193285Clone name: TUS-67-N3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C98281 [cLEY-26-P14] Trace: SGN-T121598 EST: SGN-E309780 Direction: 5' Facility: TIGR
Clone: SGN-C193285 [TUS-67-N3] Trace: SGN-T346004 EST: SGN-E545129 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E549156Length: 560 bp (910 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E549156 [] (trimmed) ACTGCAATCATTACCTTTTTTTCCTTTACTTTTTCTATTTTTACATATTCATTCTCCCAAAGGGGTTCAAATTACAGGGCTTGAACAACACACAT
ATCCATACACGATACAAACTAACCTAAGAATACATAATAATAATAATAATAATAATAACCTACTCATCTATCAAGCTCTACACCTAGGTGGGTGA
ATATTCAAGTGCATCAAGCGAAATCATTCCATGCAAACCTTGCAAAATTAAGCTCTCAACAGGACCATACAAGAATAAACAAGCTAATCAACTAT
GCATTTGGTGCAATGCCAAAACCGCACTGCAATAGTTTGCTCGGGAATTCCTTAATTCTTGAGGCAAAATTTTCAGTACAACACCTTCTCTTGAT
TATTACCTTTCTTTTATTCATACAACAACAGAGCTTGCTAAAGAGAGTTCATGCAACTCACCGAGCATCCAGTCTTCCCCAGTTTGACCTCCGAT
GACTATTGCTCTAGTTCCGCCAACAACACATGTATTATGTCCCCAAGCAATACTTGGAGCCCGACCAGTCACATTCAATATCCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E549156] SGN-U583552 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350031 [Download][View] Facility Assigned ID: TUS67N03_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0020 Quality Trim Threshold: 20.5