EST details — SGN-E549182

Search information 
Request: 549182Match: SGN-E549182
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193377Clone name: TUS-68-A23
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C100715 [cLEZ-9-I18] Trace: SGN-T122243 EST: SGN-E311638 Direction: 5' Facility: TIGR
Clone: SGN-C193377 [TUS-68-A23] Trace: SGN-T346162 EST: SGN-E545287 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E549182Length: 492 bp (919 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E549182 [] (trimmed) GGTCTTTCACTGAAAAGCTTGCTCGACTTGTCTTTATAAGAGTCTGATTATTGCCTCTCCAAAACCCAAAGAGGATCACAGAATTCTACAACCTT
GAAACTAGTCAAATGACAAGGGGCAAGTGTACCTTCGATTTTGATGAACAAATTCAAACTAACAATGTGGTGTACCGAGTTTAACTCGACATTGG
ATGATTATAAACATACTCAATAGCCTGTTCGCATGACTCTATCCTCACAGCTTCCTTGTCTGGAATCTCCAGTTTGAACTCTTCCTCCAGAGCCA
TTACAATCTCTACCGTATCTAAGCTGTCTAAGCCCAAATCCTTCTCAAAGTGGACTTCAGGGGTCACCTTGGAAGGGTCGACTTTAGGGAAGCAC
TTGACGACATCAAGGACTCTCTTGATGACTTCATCTTTGGTGATATGGTCATCGTGCGACGACATCAATCTGACAGCGGTTAGCCTCAATCCATT
TGCCGATACAGCTTGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E549182] SGN-U570432 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350057 [Download][View] Facility Assigned ID: TUS68A23_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0043 Quality Trim Threshold: 12.5