EST details — SGN-E549215

Search information 
Request: 549215Match: SGN-E549215
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193494Clone name: TUS-68-F20
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C99148 [cLEZ-16-D21] Trace: SGN-T123235 EST: SGN-E311233 Direction: 5' Facility: TIGR
Clone: SGN-C193494 [TUS-68-F20] Trace: SGN-T346363 EST: SGN-E545488 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E549215Length: 777 bp (932 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E549215 [] (trimmed) GAAAAATTAATCTAGGCTAAGAATCAAAATCTTCTAAATGGGAAGCCAAATGAAGAAGCAATCTGCTTGTGCTTTGGCATTTTTCTTGATTGCCT
CATGCACTATGGCATATTCACCTTATAATTCTTATGATTCATCAGATTCAACCTACAATAAAATACCAACCACAGAAGTCAAAAGTGATGACTTC
AAGGCACCCGAAAAGGAATATAAGGAGTCATTTTTGTCAAAAAATAATTACTACAAGAAGCCATTAGTTTCAGAAGATAACTATAAGAAAGTACC
CTCTGTTTCCGAACAGGAATACAAGGTGTCATTCTTGCCAAAGAATGACTACAACAAGAAGCCATTATTTTCAGAAGATAATTACAAGAAGGCGT
CATATGTTCCAGAGGAACCCTCAAAGGCTAAACCAGAATATAAGGAGTCATTTTTACCAAAATTTGACTACTTTAAGAAGCCATCAGTTCAAGAA
GAGGACTCCAAGAAGGCGTCATATGTTCTAGATGTACCTTCAAAGGCTAAACCAGAATATAAGGAGTCATTGTTACCAAAATTTGACTACTTTAA
GAAGCCATCAGTTTCAGAAGATAGCTACAAAAAGGAGTCATATGTTCCAGAGGAACCCTCAATGCCGAAGGAAGAATACAAGGTACCTGTTTTGC
CTAAGAATGACTACTTTAAGAAGTCATCAGTTCCAGAAGATAGCTACAAAAAGGTGTCATTTGTTCCAAAGGTGCCCTCAGTGCCTAAAAAGAAT
ACAANGTGTCTTCTTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E549215] SGN-U582153 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350090 [Download][View] Facility Assigned ID: TUS68F20_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0076 Quality Trim Threshold: 14.5