EST details — SGN-E549224

Search information 
Request: 549224Match: SGN-E549224
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193526Clone name: TUS-68-H4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C99388 [cLEZ-17-F21] Trace: SGN-T123344 EST: SGN-E310919 Direction: 5' Facility: TIGR
Clone: SGN-C193526 [TUS-68-H4] Trace: SGN-T346418 EST: SGN-E545543 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E549224Length: 787 bp (881 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E549224 [] (trimmed) AACATTATTTTACCGCAAATCACAAACTATGACATATATGAATGATGATAGTCTTTTCTGATGGTTTATGGTTATTTTCGCTTAGCGATTCTTCA
GAGTCTAACAAGATCAAGACTAGTCTTATCAAGTGGTTTAGACAAAAAGTATGAGACATAATCAACCACTAGAACTTGTTTATACAGTGGGGGGT
TTTGTTCTGATATGAGCTCTTTGATTGGACCAAACATCTTTGGAGGTGTAGAAACTCCACTGAAGAAGAATATAATTGAAATCCTTGGTTCTGCT
GCCTCATTTGCTACAACTCTATGAGTTGCACTTACAAACTTGTCATTTGATAGGATCTGAAGAAGGTCACCAATAATAACAACCAAACCATGTTC
AATCGGTTCAACATCCGCCCATTGGTTATCACACATGACTTGAAGCCCACCAATCTGATTTTGAAGGATAAACGTAAGGAAAACAGGATCCGTAT
GCTTACCAGTACCAAGAGTTAGCTCTGGCTGTGGGCATTTCGGGTAGTAATGGCATGCCATCCCTTGTTCTTTGGCACATTCTGTAGCTTTCAAC
TGGTCAGGTTTGAGCCCAAGACCTTCTGATAGTATGCCAAAAAGAATTTCCCCTAGTTTATCGACATGATTTGTGTACTCAACGTATTCCTTCCT
GCAAACTTCTGGTAATTCTTCAGGTTCAATGTGACCAGAAACTAGCCCAGCGACATACAATGTATCCTTCCAGTGTGCAGTCTTTCCTTCTGTTT
TGTACACATGAACATTGCCATCATATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E549224] SGN-U579343 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350099 [Download][View] Facility Assigned ID: TUS68H04_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0018 Quality Trim Threshold: 14.5