EST details — SGN-E549256

Search information 
Request: 549256Match: SGN-E549256
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193639Clone name: TUS-68-L21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C100134 [cLEZ-20-J15] Trace: SGN-T124085 EST: SGN-E312617 Direction: 5' Facility: TIGR
Clone: SGN-C193639 [TUS-68-L21] Trace: SGN-T346612 EST: SGN-E545737 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E549256Length: 822 bp (899 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E549256 [] (trimmed) AATAACACTTTTATTTCATTGATTTGTTAATATAAAATTGATGAAATAAAGTTCATCAAATCGAGAAAATGTTTTGTCCAATTTGGACAGTGTAA
ATAGAAGCAAGTAGGAGTAGAAAATCACTATTTGTTTTAGAACATTCTTCAGAATTTGGTTTCGAAATTTTACATCGAACATGTGGTCTCTGCAT
AAAAGTAGGGGTTTAGGCCATAAGTAACTAATTATAGTTCGTTCACTTCAGAAAGCAGCAGAAGTGTTTATGATTGCAATATTTTCTTGTAATCT
TGGAATGTCCCGTCAAAAGGCGTCACTCTGCCCTCAGAGACAGCCCAGAGTTGATCAACACTGCCAGATATTAAATGTTCATCGTGACTGACCAT
CAGGACGCCTCCTTGGAACAAGACAAGACCTTGTATCAAGGCTTCCACAGCGTCCAGATCCAAGTGATTTGACGGCTCATCAAGAAGCAATATGT
GAGGTTTCTTGAAAGTTATCTTTGCAAATGCAACTCTGCTTTTTTGGCCACCAGATAAAGTGTACATGGGCTGAAGAGCAAGATTTCCGGTTATA
CCAAATGAACCTAGATGACCACGTAATTTTTGTTCAGGCACTCCTGGAAAGCAACGCATCATGTATAAGAGGGGATTTGAGGACAGATCCAGCCC
ATCAACATGATGCTGACTAAATACAGCAATACGGACCTTAGCAGAGCGGAAAACAGTCCCTGAGGTTGGTTGAAGCTCCCCAGAAATAAGCTTAA
GTATTGTTGACTTTTCAATACCATTAGGACCAACCATTGCTACTCTGCTANTCAAATCTATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E549256] SGN-U566380 Tomato 200607 Build 2 58 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350131 [Download][View] Facility Assigned ID: TUS68L21_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0069 Quality Trim Threshold: 14.5