EST details — SGN-E549296

Search information 
Request: 549296Match: SGN-E549296
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193781Clone name: TUS-69-B19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C101040 [cLHT-11-N10] Trace: SGN-T171448 EST: SGN-E359246 Direction: 5' Facility: TIGR
Clone: SGN-C193781 [TUS-69-B19] Trace: SGN-T346856 EST: SGN-E545981 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E549296Length: 809 bp (872 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E549296 [] (trimmed) AATGTTCTTTCTATTGCCTTTGCATTCTATGAAATTCTATGGTTTTTCCTTGCAATTGAATTTGTTGAGTCACAACAGAAGAAAATGTAACAAAC
ACAAACACTAACTATGAAAGTAGAAACTTTTGTTCACATCCCAGCAATGCAGTAGACTTGAATCCTAGAGGTTACACACTAATGTCTTTTCTTGT
GCCTTTTCATCCTCGTAAGAATTTTGTGTTCCAATTTTACATCCATCCTCGAAAACCATGCTGGATATTGAGTTGACAGCATTATGTATATTATG
GACAGTCCAATAACAAGTCCACAACCGTAACCCATGAGAACCGCCTGCCAACTGATCATTGGTGAATCTTCTTCTTCATCTAGCTCAAATGGAGT
TGTTGCTTCTGGTACCCCTTCATCGACGCCACAATCTTTTGAGAGTGGAAATCCACGTAACCCATCATTCCCTTGGTATGAACTATTCTCAAACG
TATCAAATTGTTCTCCTTTGGGGATGCATCCAACAAGATGATTGTGAGAGAGATTTAAGACTTCAAGTGATTTGAGGGATACCAGCTGTTGTGGA
ATTTCTCCGCTGATTTTGTTGGATGAGAGATCCAATGATTCAAGTACAGATAACTGGTGCAGTGATGCTGGTATGTGACCTTCCAAGCGATTGTG
AGACAAGTTCAAAGTACGAAGCGCAATGAGATCTCCAATAATGCTTGGGATATTACCTTCAAATCTATTCCTTGAGAGATTGATAATAATCTCTG
TAGTCAAAACTCGAGGAAGTTCAAGCTCCAGTCCCTTTGTTGTCACTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E549296] SGN-U582500 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350171 [Download][View] Facility Assigned ID: TUS69B19_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0035 Quality Trim Threshold: 14.5