EST details — SGN-E549402

Search information 
Request: 549402Match: SGN-E549402
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C194157Clone name: TUS-70-B11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C102889 [cLHT-32-A11] Trace: SGN-T171926 EST: SGN-E357956 Direction: 5' Facility: TIGR
Clone: SGN-C194157 [TUS-70-B11] Trace: SGN-T347502 EST: SGN-E546627 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E549402Length: 522 bp (976 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E549402 [] (trimmed) CTATAAAACATTCTCATGGCCCCTTCTTTACCATTAAACATCAGTCGAACAGTTTTGATAGGAGGTTCACAAGTTAATATACATATAGTTAATAT
ACATATATATATATATATATTTAATTTTCTAATATAAATACATGATCTACGGAAAAACTATGGATTCATAGACTCCACTTTATTAAGTTTTTGCT
ACTTCCATGCCAATTGAAATAGTGCTTCATGTCCAATTTGATCCCATATATATAGTACTATAGTGAAATCGGGACAAGTCGTAGAGGACGTAATT
TGCCTACAATAAGACCACTTTTCTCCTCCGCATCCAAATCATCGTTGCCTTCAACAACCCACTCAAATGAATTCAACAACGAACCCAACATTATG
GGAACCGTCCTCATAGCCAAAGATATTGCAGGACACATTCTTCGACCAACACCAAAAGGGAATAAGCTTAAAATCATCTTGACCACGAATATCCA
TAACATTAGAACTCCAAAATCTTTTCAGGGGTAAATACCAAAGGATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E549402] SGN-U566284 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350277 [Download][View] Facility Assigned ID: TUS70B11_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0030 Quality Trim Threshold: 20.5