EST details — SGN-E549480

Search information 
Request: 549480Match: SGN-E549480
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C194433Clone name: TUS-70-M23
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C107969 [cLPP-7-G23] Trace: SGN-T173145 EST: SGN-E360742 Direction: 5' Facility: TIGR
Clone: SGN-C194433 [TUS-70-M23] Trace: SGN-T347976 EST: SGN-E547101 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E549480Length: 786 bp (885 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E549480 [] (trimmed) ACCTAAGAAATAAGATTCCATGTATAAATACCATAGTTGATACATAATGACCTGTGCAAATTCGAATAACAAACTAGCGTAAATCGCGCATTTAC
TTTCAAGATAATGTTGGATTAAGCTTTTGGTGGAAGAGAGGGATTGGTGGATTCCTCAACTCCGATTTGAGTCTCGGTATGTTCTTGTTTTGCAG
TAGTTGCTGCAACTTCTTGCACATCATTTTTAGCAGAAGTTGCAGCATGTTCTTGCACATTACTTTTGGCAGAAGCTGCAGCAAGTTCTTGTACA
TCACCTTTAGCAGAAGCTGTAGCAAGTTCTTGCACATCACCTTTAGCAGAAGCTGCAGCAAGTTCTTGCACATCACCTTTAGCAGAAGCTGGAGT
GAGTTCTTGGACATCACCTTTAGCGGTATCTGCAGCTTGTTGTTGCACATTACCTTTTGTTGAAGTTGCAGTATTTTCTTGTGCATGACCTTTAG
TAAAAGTTCTTCTTTCTTCTTCAGCCAGTTTTTCCTTTGTCTTCTGTCCCACTTCCCCGGCAGCCTTAGTGACTCGACTTAATGCACCTGCAGCC
CAAGTTACACCGGTCAAAGCATATCTGTTCTTCATGATGGCAGATCCAGCATTGCTAACTGTCTGTTCAGCAGCTGCAAAAGCAGATTTTGACTT
TTCTGAGACTTGGAACTTCTGGTCCATTTCTTTCACTTTGTGGTTCACAATGGTCGCTCCTGTAGTGATTTTCTCACTAAGGCCATATTTTTGGT
CTATAGAAGCAACTGTGGCTGAGGTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E549480] SGN-U572460 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350355 [Download][View] Facility Assigned ID: TUS70M23_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0015 Quality Trim Threshold: 20.5