EST details — SGN-E549559

Search information 
Request: 549559Match: SGN-E549559
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C194712Clone name: TUS-71-I14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C104787 [cLPP-16-A22] Trace: SGN-T176344 EST: SGN-E363962 Direction: 5' Facility: TIGR
Clone: SGN-C194712 [TUS-71-I14] Trace: SGN-T348455 EST: SGN-E547580 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E549559Length: 832 bp (906 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E549559 [] (trimmed) GGTGAGATTTGCCATCAGCAATACCAGCCTGGTTACACTGCCCCTCCTCGAGCTCGGTCAGAGGATACAATTATAGATATTGGGGGAGGATGGCA
AATTGCTGGCACACCTCTGGAATTACACGATCCTCGCCTTTTGGCAATTAGAGAGGCTGAACGCCAACTTTTGGAAGCTGAATATGATGATTATA
ATGCTACAAATGCAAGTGGTGTTGCGTTCTGCCGTTCTGCTGCTCTAATTTTAATGGCTTTTCTGCTCTTGCGACATGCATTACCTGTAGCAGAT
GCAGATGGAGATGACGAAGATCCCTCTGCTTTCTTCTCGCTTTTCTTGCTTCGGTTAATTGGCTTTCTTTTACCTTGCTACATCATGGTCTGGGC
CATCAGCATTTTGCAGCAGCGCAGGCAAAGAGAGGAAGCTGCAGCATTAGCAACAGCACAATTTGCATTTGTGGTACAATCTGGGCAGCCAACAG
GTGTACAGTTTGCCATGGCATCAGCTACACCATCTGTTCCTGCATCAACGGACTCTTCGTCTGTGCCTGCACCAATGGATCGGGTTTAATATTGT
CACATGCGAATATTGGTTCCTGTCATGAAAGCTTCCAGCTGCAACGAGCCAACGAGCCTCGTTTATTAAACGTAGATGCTGCGTCGTTTTGTAAG
TAGTATTGTGGATATAATAGCAGCATCTCATGTCATTTCATGAACCAACAATTTTACCAAGCTGTATATTAAAATTCTTTTGATCTTGGTATGTA
TGTATGACATTTAGTAACCATTTTCACATCTGGTTGAGACCAGTTTTGTATAATATGTCTTGTAGAAACCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E549559] SGN-U573344 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350434 [Download][View] Facility Assigned ID: TUS71I14_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0039 Quality Trim Threshold: 14.5