Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E549562

Search information 
Request: 549562Match: SGN-E549562
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C194723Clone name: TUS-71-J1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C104884 [cLPP-16-F7] Trace: SGN-T176404 EST: SGN-E364022 Direction: 5' Facility: TIGR
Clone: SGN-C194723 [TUS-71-J1] Trace: SGN-T348474 EST: SGN-E547599 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E549562Length: 769 bp (892 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E549562 [] (trimmed) GAAAGTTAATGATTGGTACTTCATAAACGGTTATTTTACTGCACTATCAGTGCAATATGTCTGTAACATTTCTTACAATTTCAAAAGGAGACGCT
TTGTAAGACGTTGTGGCTTCATTTTTGTTTTTTTACCATTTATATATATATATATATATATATTACCATAAAGAAAAAATGGAGTTGGAATTAGA
ACCTCCATGATCATTTTTCTTGGCAATTGCAGCTACAGGAGGTAGTGGTGGAGTAACAAAGTCTTTAGTCTCCAAGTACTCTGGAGGGGGAGGCT
TGTACTCTTCTACTTCTTTTGGATCGAGGGCATACGTTATCACTTCCCCTGGATTTATCTCTGGTATTCTATATGACTCTTTATTCCCAGTGCAC
AAATTCCTGGTGTATGCATTTGCTGTTCTTGGGTACTGCGTTATAATTCCATCCGCACCATAGTAAATGAGGTTATGGATCAAGGTGTATGGATC
GGAGTTAAAATCCATGTAAATATCTTGGAATTCATTCAAAACAGTTCCAGCATAGACACTAATATTGGCCCAATGCATACATTCAATAAGGTTGG
TCAAGTTCAAAGTAAAACCCTCTCCTCGAAATTGTGTGTATAAGGAATGTTTATGTAAAAGTACTGCATCCGCATGCTTCTTGATTTCTAATGCT
GTCTCATTCGTTACAAATTCAACCTTCTTCTTAATGTGAAGTACTTTTTGGTAAGTCGAGATATCCTTGAATTTGTCTAGAACTGAACTTTCACC
TGACATGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E549562] SGN-U564899 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350437 [Download][View] Facility Assigned ID: TUS71J01_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0056 Quality Trim Threshold: 14.5