Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E549579

Search information 
Request: 549579Match: SGN-E549579
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C194783Clone name: TUS-71-L13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C105247 [cLPP-17-I17] Trace: SGN-T176798 EST: SGN-E365086 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E549579Length: 709 bp (872 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E549579 [] (trimmed) GCTTCTCTTTCTCTCTCTCTCCCTCTCCTGCTCTTTCTTCTTCTTCTTTCTTCCCCTGGATCTTCAAACCCAACCCAATCTCTCCAAATCATAAA
AAATCGAAACAATCCTTTAATTTCTGTGTTTCTTTAACACATTTTTCTCAAAATCTTTCTTTTTAACTTTTTTTTTTTTGGACTGATCTGGTTTA
GAAACGGGTCTGATTTGATCACATCGTGGGAGATTGATAAAAGGGGAAGATCCTTTCGTCATATAAAGAAGTGGGTACTTTTTTATAAGCTGTCC
GTTAGAGGGCTGTTGAATAAAATAGGAAAGAGTTACCCAGTGGTGCAGCGGCTGGAAGAAGTTTAGTACAGGGTTGATAGAAAATCCTTATTCTA
TATTACCTAGTCCTTCTTCACCTTCATTATACAACTTTTATTATCTGAGATTCCTTTCTTCTCTTCTTAAACCAATTCCTAAGTGGAAGTGCTTT
GTCTTATATATGCTTGTATTGCCTTGCACGTTTCCTTGAGGGCCTTCTGCCTATTTGTGCTTTAAGTTTCTTGTTTTTGGTGTTTAGCTACAAAA
TAAGCAAATATGATGTTTTAGCTTGCCATTTTACACATAGAAGATGGCGTTTCGTTCTGAGGAAACACAAACGGAGGATTACCTTTTCAAGATTG
TTTTGATTGGTGATTCAGCTGTTGGGAAATCAAATTTGCTTGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E549579] SGN-U564984 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350454 [Download][View] Facility Assigned ID: TUS71L13_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0037 Quality Trim Threshold: 14.5