EST details — SGN-E549596

Search information 
Request: 549596Match: SGN-E549596
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C194844Clone name: TUS-71-O2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C105808 [cLPP-19-N4] Trace: SGN-T177006 EST: SGN-E363158 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E549596Length: 591 bp (903 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E549596 [] (trimmed) ACTTTTTATTCATTGATTTTTNTGGGGGAAGGAAAACAAATACATTGGAATCCATTAATAGTTAAGCCGTTCCCCTTTATTATTAGATAGAAAGA
GAAGAGATTAAATTAAGCCTTGTATGGAGCTGGGAGGGGCATGCCCTTGACAACACCGCAGAGAGGATGGTTATCAGGGAGGTTGTATTCATCTC
TCAAGGAGCGGCTTGGTGAGAGAACGCTGAAGTACATTTGCTCTCCCAAATAAGTCTTCTCCCACATCTCTGACCTCAAGTTCCACATTCCTGCA
TTGTCAAATGTCAACATTATTGCTGCCCATGAGTTTGGATACACCTGGATGTTGTTCCTGCTTGTTGCGTCCACTAAGTTGTAGTTCTTTCTCTT
CTCTGCGCTCCACCTCCCTGGCTCAACAGCTACTGCAAAGAAGGAATATCCGTCAAGGTGATATGTCCTGATGCTCTTCTCGTGGTTCTCAAAGA
TGATCTCCACAAAGTTACGGGAGGTGGTGTTTTTCACATTTGGGGCAACAGTTAGCTTGCTTGGGTCAGCTGGGGCTTCATCAGCCATGAGATCA
TACTTGAAGCTCTTATCGGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E549596] SGN-U578153 Tomato 200607 Build 2 112 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350471 [Download][View] Facility Assigned ID: TUS71O02_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0096 Quality Trim Threshold: 14.5