EST details — SGN-E549617

Search information 
Request: 549617Match: SGN-E549617
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C169610Clone name: TUS-6-C16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C25822 [cLEF-1-J5] Trace: SGN-T59029 EST: SGN-E243025 Direction: 5' Facility: TIGR
Clone: SGN-C169610 [TUS-6-C16] Trace: SGN-T350794 EST: SGN-E549919 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E549617Length: 731 bp (772 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E549617 [] (trimmed) CATTCCTATTGAAATACATTGCCTTATGTCCAAAGCAGTTTTAGATAATCTCCCACAGAAAATATTGACGATAGCAACATAACTATATGCCAGCA
AAAATAAGAAATAAATTATCTATGGAAGACGCGAGATACTGATCACAAGTGCCATAATAGTAGTTGCTTCCTCACCTTGCATCGAATTCAACCGA
CCTGAAAAACATATTTCATCCACTAGAATGTGGTGTGGAGCTGTCAACTCATTTGTCAGCGGCAACTGAATCCGGAGAAGAAAGGGAGTCCTTTA
GGAGCCCAGCATCATCTACCACAATATCCAGTACCTCAGCATTGTGTGCTTTCGACTCTCCATTCTGGATGCCTCTCAATGTCTCCAGCACTTCT
TGCATTGAAGGTCTCAGATCTCTCTCTTGTTGCAGACATCGGAAAGCTAACTCTGCGACTAATGTAGTCATCCTCCTCACGGAGCTGTTTGTTGA
GAATCCAAGAGTTGGATCAACTAATTCATGAATTGAATGACCTTGGATCTTGTTGACAGCCATATTAGACAAATTAATATCATGGCGGTGCCTGT
TGGTATCCACAGCTTCTAATGATGAGATCAGCTCTACCAACACCACCCCAAAACTATAGACATCACTCTTTTCAGTGAGCTGGTAACATTGGTAG
TATTCAGGATCAACGTAGCCTGGTGTACCCTGTGGAGCAGTAGAGACATGTGTGACATTATTTGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E549617] SGN-U569715 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350492 [Download] [View] Facility Assigned ID: AGT-287_F06_TUS6#2-C4.Td_057
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0020 Quality Trim Threshold: 20.5