EST details — SGN-E549637

Search information 
Request: 549637Match: SGN-E549637
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C169598Clone name: TUS-6-C4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C169598 [TUS-6-C4] Trace: SGN-T350673 EST: SGN-E549798 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E549637Length: 336 bp (796 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E549637 [] (trimmed) GATTATAACACTGAATTTTCCTTCCGAAACGAACAACTGCCAAACAAATCTCTAGCAAATACATTCAATAAAAAAACCTAAAGAATTTTGAGGTA
AAGATAAAAAAAAAAGTGGATGTATACAATTATTTAAGCTCTATGGAAATCATTGTGCAATGGGGAATTTGGAGTTAATTTCTTATGTAGACTTT
TTGTATTGGTATTTGTTTTGTTGAGAAATTCCCTTTGAGGACTTCGTTTGTGTTGATCAAGTACTGGAGCTATATAGACAATTTTCCTTGTTGAA
ATATCCTTATAATCCTTCAATGTTTCAAGTGTTTTGACAACTGAAGNCTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E549637] SGN-U569230 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350512 [Download] [View] Facility Assigned ID: AGT-290_F05_TUS6#1-C4.Td_045
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.908 Expected Error Rate: 0.0096 Quality Trim Threshold: 20.5