Notice: The contact form functionality has been restored. Apologies for any inconvenience.

EST details — SGN-E549640

Search information 
Request: 549640Match: SGN-E549640
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C169645Clone name: TUS-6-E3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E549640Length: 611 bp (761 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E549640 [] (trimmed) AGGTATGAGTATTTCCAACTAAGCAGGAAACACCTAAATAGTCTTATTAAGATCGACCCAACAAATAGAACTACAACTAACCAACCAAACTAGAG
AACATTTTCATATATTAACAGGAAACATATCATGTGAATGCACCCTTCTAAACTGCATGGATTGGATTGTGGCTAGAGTTCATGCCTGAGCTACC
AGATGACGGATTAGCATGGAAAGCTGACTGCCTGGAGGAGCCCTCGACCAGCTTTAGTGACAGAGAAGGTGGCTTGGCAGCATCACCAATGGACT
CACCTAAGCTTAGCTTTGACATACCAACCAGCTCATCAACATTAATTTTTCTCTTTGAATGAACAGCTGTTGGCTTCAGAACTTCATGGGTCTCT
GCTATTGCTGGCTCTGCAGTGTAACCTGGCCAGCATGGATAAGGCATCGGGTAAAATGGAGCAACATAAGCAGGATAAACAAGTGGATGCTGATA
TTGTGAGCTTTCTGGTATAGAAAGAGCATGTTCCCCATCGATGGAGTTGGCAGAAGCTGCTGAACCCATTGATTCACATTCTTCATCCACAGCAG
GAGTAGGAGGCAACGGATTGTTGCTTTGCATCTCAGCTTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E549640] SGN-U582548 Tomato 200607 Build 2 27 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350515 [Download] [View] Facility Assigned ID: AGT-290_D05_TUS6#1-E3.Td_044
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0113 Quality Trim Threshold: 20.5