EST details — SGN-E549666

Search information 
Request: 549666Match: SGN-E549666
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C169887Clone name: TUS-6-O5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C22319 [cLED-37-K4] Trace: SGN-T57952 EST: SGN-E242131 Direction: 5' Facility: TIGR
Clone: SGN-C169887 [TUS-6-O5] Trace: SGN-T350643 EST: SGN-E549768 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E549666Length: 450 bp (787 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E549666 [] (trimmed) CTGATTGCGGTCATACATAAGCTTAGTTGCAATAGGAGATGACAGCCTACTGCATCTATTGCAAACAAAAGTAATTAACATGCACCCAAACTAAG
GGGTGGGATTATTATAAAAAAACAGACGACCTCGACCACAAACTAAAACAAACTGGAGATGCTAACAAGAGACACTTCAAGCAGAGTTTAGTAGG
ACCAAATCTCATCTTCCTCTGCTGCAGCATTGTCTTCACTGTAATAGTAATAGCCACCATTATTGGTATTGGTATTGGCATTGGCAGTGGCTTCT
GCAGTGAAGCAGCAAGACGAAAGGTAAGGCATGTTGTGGAAGGACTGAGCTAAGCTGCTGGTCAAAGATCCAAAGGCAACACCTTCGCCTTCTCC
TTCTCCTTGTTCCAAGAATTCCTCTGCACGGTGCTTGAGAGTCTCGAACATGAGTTCAGGCTCAAACTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E549666] SGN-U578034 Tomato 200607 Build 2 225 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350541 [Download] [View] Facility Assigned ID: AGT-285_F02_TUS6#3-G5.Td_025
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0015 Quality Trim Threshold: 14.5