EST details — SGN-E549678

Search information 
Request: 549678Match: SGN-E549678
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C169866Clone name: TUS-6-N8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C169866 [TUS-6-N8] Trace: SGN-T350654 EST: SGN-E549779 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E549678Length: 747 bp (786 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E549678 [] (trimmed) GTGAAGTTAAAACTTCAAGGCGTACAAGATTTTGAGAGAATATCCAGTTGCTGAGCTAAAATACAACACTTCCCATAGTTGTACAACTTTCAGAA
CAACCTCTTACAAATCCATTGCTCAAATGTTACTATTTCTAACTGTACGTTTGAACTTCACCCTGCCCTTACCATAGATATACATTTATGTTAGC
TTCAAATCTCTGCACCTTCGGTATGTCCTCGAGAACTCTCTGACAAAATTGCTTTTCCCTTACTATCAGAAATTCCTAAATCATCTGCTTTTTTT
TGTATGTTTGGATGCTCTAAAAGCTTGAGCTGGGTTTGCAGAACCTCAATTTGTTGCTGTAAAAGTATCTTATGGGCCTCAAGTTGAGACGTTGG
AATACCAAGGTTGTTAGCACCTGGATATTGAAAAGGGAGAAAACCGGATTGTGGATATTGAGCAAAGGGCATATTTGCTAATTGATTGTGCGATG
ATTGTTCATTCAATGCCCGTTCCCCATCTGAGAGCACATTGGCAGAACTGCCCACTGTACTATAGGAGGGAGGAACTGGAGCATATCCAGGAGAC
CACGCTAGTGTTGGTACAGAAGGATAAACATAAGACTTCTGATAAACTGCTGCTGCTGCTGCAGCAGCTTGGATTCTAGCTTGGTGCTGGCTAAC
ATTATTACTTGGCGTGGTGTTTGCTTGCGAACCCTGAGATGCACTTGCCGCACTTGATCCAGGGCCTTGTTGCACATCTGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E549678] SGN-U564900 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350553 [Download] [View] Facility Assigned ID: AGT-287_F08_TUS6#3-F8.Td_073
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0072 Quality Trim Threshold: 20.5