EST details — SGN-E549761

Search information 
Request: 549761Match: SGN-E549761
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C169790Clone name: TUS-6-K4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C26224 [cLEF-3-G6] Trace: SGN-T59421 EST: SGN-E244440 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E549761Length: 590 bp (793 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E549761 [] (trimmed) ATCAACCGGGCTGAAGGAATTCCCCACGAGAAGAACTGGTCCTTTTTCCAAAGATAGCTCAAGGTGATTTTGATAGAAGAACTGTCTCTTTGATG
GATCAGGATCATCTTTGTGTGTCTTCTACTCGTGCAAATGTTGATGATGGGGTCTCTATGGATTATGGCTATCCTCCTTTCAAGGGTGATGGACC
AATGATAGATCATATGGACTCTCAGCTCAATATTGAAGCTGAATTCCAGCAAGCATCTCCTGAAATTGTTGTCCCAGACACCATGGATTTGCCTT
CCGGGTACAACCCTTCTCAAACCGCTGACGTTCAAAGTATGCAGTATGATGTTGAATTGAGTTCAAAAGTACCTGAATCGGGTTATCAGGATGAG
AACCAAGGAGCTCAGAATGCTGGCTTTCCGCTTACCAATCTCCCGCTTGGAGACTTTGATCCCAGCACTTTGCAGATAATCAGTAATGAAGATCT
TGAAGAGTTAAAGGAATTACGATCTGGAACATTTTGGGACCGTATATCATGGAAAATGGAAAGGGACTGATGTTGCCCTCAACAGAATAAAAAAA
ACCTGTTTCACAGGTCGGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E549761] SGN-U577536 Tomato 200607 Build 2 26 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350636 [Download] [View] Facility Assigned ID: AGT-284_C04_TUS6#3-C4.T3_022
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0049 Quality Trim Threshold: 20.5