EST details — SGN-E549768

Search information 
Request: 549768Match: SGN-E549768
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C169887Clone name: TUS-6-O5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C22319 [cLED-37-K4] Trace: SGN-T57952 EST: SGN-E242131 Direction: 5' Facility: TIGR
Clone: SGN-C169887 [TUS-6-O5] Trace: SGN-T350541 EST: SGN-E549666 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E549768Length: 490 bp (798 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E549768 [] (trimmed) TCCACGAGGCAGTTTGAGCCTGAACTCATGTTCGAGACTCTCAAGCACCGTGCAGATGAATCTCTTGGAACAAGGAGAAGGAGAAGGCGAAGGTG
TTGCCTTTGGATCTTTGACCAGCAGCTTAGCTCAGTCCTTCCACAACATGCCTTACCTTTCGTCTTGCTGCTTCACTGCAGAAGCCACTGCCAAT
GCCAATACCAATACCAATAATGGTGGCTATTACTATTACAGTGAAGACAATGCTGCAGCAGAGGAAGATGATATTTGGTCCTACTAAACTCTGCT
TGAAGTGTCTCTTGTTAGCATCTCCAGTTTGTTTTAGTTTGTGGTCGAGGTCGTCTGTTTTTTTATAATAATCCCACCCCTTAGTTTGGGTGCAT
GTTAATTACTTTTGTTTGCAATAGATGCAGTAGACTGTCATCTCCTATTGCAACTAAGCTTATGTTATGACCGCAATCAGTTTTATATTAATGCT
GTCTTTTTTTGTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E549768] SGN-U578034 Tomato 200607 Build 2 225 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350643 [Download] [View] Facility Assigned ID: AGT-284_G05_TUS6#3-G5.T3_035
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0039 Quality Trim Threshold: 14.5