EST details — SGN-E549769

Search information 
Request: 549769Match: SGN-E549769
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C169889Clone name: TUS-6-O7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C22339 [cLED-37-M5] Trace: SGN-T58017 EST: SGN-E242196 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E549769Length: 726 bp (786 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E549769 [] (trimmed) CGCACCAGGGTGACGAGGATTCTGATTTCACAGTCACGGGTATACAAAGTTATAGAAAGGCCGTAAATGCAGCCAAAAACTCTTCAAAGGGTAGT
GGTGGACAATCTGGCCCAAGCAATTTGTTTAAAATGCCGATAAATCCACGTGGGCAAAAAGACAGCAGCAAGAAACGAAGGGATCAGAAAACAGT
CTCCTATGCTCTTCCTGTCTCCTTTGTTTCAAGTGGTATCATGCGTTCAGAGACAGAAGTTGAGGAGAAATCAATCGAAACAACCCAGACAACCA
CCATTGTCCATGAAACAAAGGTTGTGACCAACTCAGTCGAATACGGTGCATTCGAGATGCACACTACAGGTATTGGCTCAAAACTCATGGCAAAA
ATGGGTTATCAAGAAGGCAGAGGCTTAGGGAAAGATGGACAGGGTATTTCTGAGCCCATCGAAGCTCGCCAACGACCAAAAGCTCTTGGATTGGG
AGCTGAAATCCCAGAAACAAGTATTAGATCATCAGGAAAGAAGGATTCTCTACCCAAATCATCTGGTCGTGGTGCTGAAGTTGTCGGTGGAAGTG
GGAAATCCATCAGGAAGGAGTCATCTGTTGGATTTGCAGGATTTGAGAGACACACAAAGGGGTTTGGATCAAAGATTATGGCAAAGATGGGTTTT
GTTGAAGGTATGGGACTTGGTAGAAGTTCACAAGGCATAACCAATCCTTTAGTTGCTGTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E549769] SGN-U584872 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350644 [Download] [View] Facility Assigned ID: AGT-284_G07_TUS6#3-G7.T3_051
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0092 Quality Trim Threshold: 14.5