EST details — SGN-E549813

Search information 
Request: 549813Match: SGN-E549813
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C169619Clone name: TUS-6-D1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C27541 [cLEF-44-H22] Trace: SGN-T61200 EST: SGN-E245339 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E549813Length: 666 bp (793 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E549813 [] (trimmed) CAACTAAAGAATCTTTGCATGATAATCAACCGGAGAAAAGGATGAAGCTTGAAAATGATGGCTCTTGTTATGCTCCCTCTCAGAATCCTCAAGAA
GCGGTTACATTTTTCTCTCAGCCAAACTCAGTACAACACAATCTTGCAAGCACTGGGCGGGAATCAACTCCAACTGAACCACCTCCTCTACCATC
ATCGCCTCCACCATTGGCACCGTTGCCTCCTATGCAGCCATATCCAGCAGGTCAGATCATTCAGACATCTGGGCAGTTGCCTAGTTCAACGTTTG
TTTACGCAACAAGCCAGCAAGTGCAACCAGCTTCAACATTGGGTGGTTTTGTCCCTCCAGTGAATGGGATTTCTCCTTTCACATATCCGGCGACA
ATTGGTTATCAAGGTTATTCAAGTGATAGTAGTTTATATAGCCACCAGTCTTCATCCCTGCCGATGGCACCAGTTAGCCGTCCGTAGGTTGTTAT
TTTAGAGCTATACATAGCTTGTGTTGGTTAACTGGTCTGATGTACAAGAAAGATTAGGCTGTAACTATGTAACTTTATATTGTGTTTTTGTTTCT
AGATTGGAGGTTGTTGTTGGTGTTATTGCACTAGAAAGAAGTCGGTGTGGAAATATTAGTAAAATGTTCAATTGCTAATTAATTCTCCAGTTTAT
T
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E549813] SGN-U585621 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350688 [Download] [View] Facility Assigned ID: AGT-286_D01_TUS6#1-D1.T3_011
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0037 Quality Trim Threshold: 12.5