EST details — SGN-E549830

Search information 
Request: 549830Match: SGN-E549830
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C169827Clone name: TUS-6-L17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E549830Length: 638 bp (774 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E549830 [] (trimmed) GTGTGTTGGTTTACATAGATTTGATGTTTCTTCTGGTTGCTGTTTCACTGGTTTGCTAAGGAAAAAGTGTGAATCTTCTCACACTACAATACTAT
CTCAAATCCTCTTTGAGACTGTAAGCTTGGTATACCATAGCTCTAATGCAGGGGCAACAGAATACCGTTGGTTCGCTCCAAGAAACTTTAGGTTT
TAATCATGGTTCGACGCCTAGTGAAGGTGGTGTAGATCAACAGATATGTTGGAGTAATTTGCAAAATTCTGCACAGAATCACCTGCCTGATTATA
TGGTTTCTTCAAATGCGACTGATATTCCATTCTTCAATCCTATGAGCCAAGAGAGACAGAATGTAACCAGGGGGAGTTTAGGAGAATCCAGCTCC
TCTATTGCACCGAATTCTGCAAGTTGGAGTGAACAGAAAGCAGATCATGGATGGTCATCCGCAATGACTACATATAATGGACCTTCACTAATCTG
TAATGAACAGCGATGTGGGTCTTCTAACATTATGTCATTGAATGATTTTTTTTCTCAAGGTTCTAGTTCTAGCACCATTCCTCATGAGATCAACG
GGAATCCGGCATTTGAGGGGCGCAGTGACAATAATGACGATGGCTGTCAAGTGATGGAGTGTACTCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E549830] SGN-U563918 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350705 [Download] [View] Facility Assigned ID: AGT-291_C03_TUS6#4-D5.T3_020
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0106 Quality Trim Threshold: 14.5