EST details — SGN-E549863

Search information 
Request: 549863Match: SGN-E549863
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C169851Clone name: TUS-6-M17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C22214 [cLED-37-D12] Trace: SGN-T57966 EST: SGN-E242145 Direction: 5' Facility: TIGR
Clone: SGN-C169851 [TUS-6-M17] Trace: SGN-T351408 EST: SGN-E550533 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E549863Length: 559 bp (789 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E549863 [] (trimmed) AACGATATCTCCTATGTCTTCTCTGGGTATGCACCTCTCATTATTCGCCTAGTTCAACATGCAATTCGATCTGGGTGGCGACCTATTGAAGAAAT
ACTGAAGTTGCTGCCAGGTCCACACTCAGATATTAAGAGGGGTGGATTTTCCAGTAGTCCGTCGCTGGACTCATTAAACGGGTCTTTGCATAACT
CAGACAAAGTTGTTGATGGAAGGCGTTCTTTGGTTCTTGTCGTTTTCATTGGTGGAGTAACATCTGCAGAGATCTCTGCTCTTCGCTTCCTGAGC
GCCCAGGAAGGGATGGCATATGACATAATTGTAGCAACTACAAAAATTGTCAATGGAAGCACATTGACAGAAACATTTGTGGAGAAATTGGGATG
ATCTGCTAAGACTTATTTGGTCGATTATCACTGGGGAATCTCAGCTGCTTGCGCGATAGGGACCCATAGTTTTTGATGCTACATTTTTATATACA
TGTGAGAAGGTCAGTAGACTTAACTTGTGATGAACACAGTTATGTTTTCTTTATTAAGGTATTGGCTAAGAACGCCCTGTGTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E549863] SGN-U566649 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350738 [Download] [View] Facility Assigned ID: AGT-283_E05_TUS6#4-E5.T3_037
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0092 Quality Trim Threshold: 20.5