EST details — SGN-E549875

Search information 
Request: 549875Match: SGN-E549875
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C169921Clone name: TUS-6-P15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C169921 [TUS-6-P15] Trace: SGN-T351403 EST: SGN-E550528 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E549875Length: 724 bp (788 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E549875 [] (trimmed) CGGGCTGCAGGTTGCATTGCGCTAAACAAACAAAAAATATAAACAATTTGCTATTTTCGTTTAGCAATGGTTGACATTTAATCTTTTTTATCCAT
GTCCTCAGATTTCTGCGCTTTTTCGTTACGCTACTCTTGTTATGGAGTTCTCTTCTGAATTCGATCATGGAATTAGGGCTCAGGTTTCGTCTCAT
TCTTCGAGAGTTAGAGGAAAGTGTTGACCTATCTTCTACTTCTAAGCTATGGTTCGCCAGTCTGATTTCGATTGATCCGATAATCAGGTCCGAAA
TATACGGTTCTTCCTGAAGACAGAAGGCATAAACTGTGGAAAAGGTTGAAAACTTCAGCACTTGGCTGATGGATAGATGCAATAATGGTTCTTCC
CTCTCTTTGACGTGAAATTCCGCTCATCACGTAATAAGATGCAGCACTGTCGAGGCCGCTGGTTGGTTCATCAAGGAAAAGAAGTTTTGGCCGCG
TTAGAATCTCCATGCAAACACTAAGTCTTCTCTTTTCTCCTCCACTAATTCCTTTATTACCAAATCCTCCAATTCTTGTGTTCATTGCATCTTGC
AACCCCATCTCCTTAATAGTCTGCTCTGCTATTTGTTTTTTCTCTGATTTTGTCATGGAAACTGGGAGTTGGAGTTGTGCAGAGTAGTAAACTGC
TTCTTGAACTGTTAGTGTTGCTAACAGAGTTTCATCTTGAGTCACATATGCCTGATTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E549875] SGN-U573391 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350750 [Download] [View] Facility Assigned ID: AGT-283_H03_TUS6#4-H3.T3_030
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0077 Quality Trim Threshold: 20.5