EST details — SGN-E549970

Search information 
Request: 549970Match: SGN-E549970
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C169469Clone name: TUS-5-M19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C169469 [TUS-5-M19] Trace: SGN-T351111 EST: SGN-E550236 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E549970Length: 648 bp (804 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E549970 [] (trimmed) GCAGACTGGCGACCATAATTCTGTTAGAGAAGCTACAAGACCTTCAGAAACCAATGTGAGCGACTTCCAGCAAGCAGATATCTTAGGTGGGAATT
CTATCAGAAATGAGCCTCCAGTTGGAGGTGCTACAGCTCAAATGGAGAGTCCGTTGACCTCTTATGCTCCACCTGCCCATGAGGTTCGTAATGTG
TCCGATGTTGTGAATTTGGGAAGTGGTATGCTTACTGATGCAGTCGATGGTGGTACTAAGGTGTCTAAGGAGAATTCTTCTGCAACTAATGACTC
TTGAATCCTTTATTTAAGAATCAAACAGCTTGGAAAAAGATTTTCTCAATCAAATTATTTGAGATAAGAATCAATGTAACACCGATTAGCCTTGT
GCAATTTTATGGAGATGGCGGAGGGAATTAATTCACTTCATCTCTACAGTCTGCTTGAGGATATTATAGTTTCATTTTCCTTAGGTTTGATATTT
CTGGGTAAAGATTCCCAATGAATTTATATGAAAAAAAAAAATCATATCGACTGCGGTGTTGTGGTCACCAGCTTAGCTAATAGTAGAAGCTTTAG
TGAAATTCAAGGAGACAACTTTACTAATCACCTGTTAAACTGTTTTTAATTAACTATGAAGTGCTTATCTGCCTCCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E549970] SGN-U580268 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350845 [Download] [View] Facility Assigned ID: AGT-277_E07_TUS5#4-E7.T3_053
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0042 Quality Trim Threshold: 12.5