EST details — SGN-E550006

Search information 
Request: 550006Match: SGN-E550006
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C169531Clone name: TUS-5-P9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C19484 [cLED-26-O9] Trace: SGN-T55416 EST: SGN-E241222 Direction: 5' Facility: TIGR
Clone: SGN-C169531 [TUS-5-P9] Trace: SGN-T351266 EST: SGN-E550391 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E550006Length: 671 bp (786 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E550006 [] (trimmed) TAAGAACCCCAATAGATCGTGTCCTATTTTCCCCATCAAATCCCCAATTTTCAAGAACTCAAAAAGTGTCTTTTAGAGTAAACTCAAAACTTAAC
AACAATGTGATAGAAATTAGTGAATCAAAAAGCTTTTATGAGCTTTTGGGTATTCAAGAAACTGTTTCTTTATTAGAAATTAAACAAGCGTACAA
ACAATTAGCAAGAAAGTACCACCCAGATGTTTCACCTCCGGGTCGGGTCGAAGAAAATACCCAAAGGTTTATTCGGGTTCAAGAGGCTTATGAGA
CATTATCGGATCCTAAATCAAGAGATATGTATGACAAACATATGTCTAAAGGACTTCATTTTGCATTTTCTCCTCGTAGAAAGTGCCAAAATGAT
GAGTCAATGGAGAACACCGGTGAATGGAAGAATCGATGGCATTCTCAGCTATCGGAGTTGAAAAGAAGAAACTCACACAAGGACTCTGGTAACAA
TATGTCATGGGGTGCACATATGCGTAGACAAAGGAGTGAAACATCGTTATAACGAATTATATAGTTTTTATATATTGCTTATATATAATTTGAAG
TGTTTGGTTAAGCATTGATGTTATAAGTAGTGTAACAACTATATGTAAGTGCTGACCAAATATAGGTAACTGTTTGTACATAAGAGTTCTTTGAA
TCAAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E550006] SGN-U581004 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350881 [Download] [View] Facility Assigned ID: AGT-274_A12_Tus5#3-H9.T3_087
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0125 Quality Trim Threshold: 14.5