EST details — SGN-E550052

Search information 
Request: 550052Match: SGN-E550052
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C169356Clone name: TUS-5-I2
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C17728 [cLED-20-G21] Trace: SGN-T53786 EST: SGN-E236269 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E550052Length: 445 bp (757 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E550052 [] (trimmed) TCTTCCAATTCATAAACAAGGTAATAACAATTGCACATAACAAATCATGCTAGATGTGGAAGGAGGAAAAAACAAAAACAAAATAAACAACAAAG
AAAAACAATCATTGATCTAGGGCAATCTATGTGGTGACACTGAAGTGCTAAATGACGTTTCCCATGAGTGTGTGGCTGTCATAATTCTTGAAACA
GATTGCACAATCTCATCCGTATTAGGGCGATGTGAGGGATCTTTCATTAGGCAGTTATCGATCAATCTGACCATGGCAAAAGCAAGTTCCACAGG
GTACTTCCCTTGCAGAGAAGGGTCAACGAAGTTGCTCAAACTCTCCTTTGCATTATCATCATTAAGCACCGGGATCAACAACTCAGCCAAGTTTG
TGTTTGAACCTTCATATAAAGCGGAAACTTCTTTCCCGGTGAGAATCTCCAGCAACAGAACTCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E550052] SGN-U564297 Tomato 200607 Build 2 60 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350927 [Download] [View] Facility Assigned ID: AGT-276_A02_TUS5#3-A2.Td_007
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0023 Quality Trim Threshold: 14.5