EST details — SGN-E550054

Search information 
Request: 550054Match: SGN-E550054
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C169465Clone name: TUS-5-M15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C169465 [TUS-5-M15] Trace: SGN-T350842 EST: SGN-E549967 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E550054Length: 743 bp (790 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E550054 [] (trimmed) AATACATATACAAGATCCAACACTCAACTATTGAGTTTACATGAACCCACACGTTACATTGCGGCTCTGCCTCACGAAGCATAAAACGACATGGC
ATAGATGTTTTGTATTTTGTGCAGGAAGAATATAATGCATTCCCAGTTACACATATTTAAACGTTACAGTCCCTTATGCACATAATATGAGTTAA
CAGATCTTCATTACTGTCTCTGTCTATATTCAGAGAACCAAGCAAACCACAGTTGGTGTTCTAGTATGTTAATTTTGTAGTACATTTCTAAGACT
GCATGCTCTTACATCTCAGCAGTAAACGATTTTCCACAACCACAAGTTTGCGTAGCGTTTGGATTTTTGAAAGAGAAGCCCCCGCCTATCAATGC
ATCGCTGTAGTCCAGTTGCATTCCGAAGATGAAGAGAAGGCTTTTTGGATCACAAACTGAAAGAAAGGGTTGATGCAACAAAAATTTCTTATTTA
AATGTCAATAATCACTCGAAAAGAAAACAGAAACAAGTAGCTAGCACGCATAACTTACAAATATAAGAGTGAAATAGTACTGGTTTCTTGTATGG
ACCCAACACTAAAAGCTTTAACTACTTCATGAGTAAAAAACGCCACACAATGGGCAAGGGGAACTTACTGAATCAAGGGTATTAAAATTCGTCTC
AAAGTGAACTAATCTAAGTAGATGGGTATGACTGCTAGCTTTAGAAGCATACAAGAGCTAAATATAGGTAATTTTTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E550054] SGN-U575653 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350929 [Download] [View] Facility Assigned ID: AGT-279_B02_TUS5#4-E3.Td_015
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0026 Quality Trim Threshold: 20.5