EST details — SGN-E550079

Search information 
Request: 550079Match: SGN-E550079
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C328544Clone name: TUS-5-A31
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C328544 [TUS-5-A31] Trace: SGN-T351160 EST: SGN-E550285 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E550079Length: 712 bp (791 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E550079 [] (trimmed) GAGCAGGCAAATTAGCTTTTATCCTTAACAAAAAAGAGCCTAAAAGTAATTTAGAGGTCATTACAACTTTGGTGATATATGCAATCTTTATTACA
ACAAAATAACATCTCCAGTCTTATCTTGCTTCAATGACAGTAATGGAACAATCATTAATTGAACATTGTTCTGTTTTGTTTGATGACGAATATGA
TTCAGCTTCGTCTCTTCCTGTGAAAAATGCAGGTTGTTTTGCGATTGGCAGTGACATACTTCCATTACCAAGCATTGAGATAACATCAGACATTG
TTGGCCTATCTGTTGCTCCTTCTTGTACACATAATAGTCCGACATGTATAACTCGTAAAAATTGTTCAGTGTCGTAAAGATCTTCAAGAGCTGGA
TCCTTCAGTTCTAGTCCACACCCTTCTTTCCATAGTTCCCATGCATAACCTATTAAGTTGAGCGGACGATTGAATTGTTGTAAGCTAGCATTTCT
CCTACCACTCAAAATTTCCAGCATTAAGACTCCAAAGCTGAAGACATCAGACTTGATTGAGAAAGCTCCTTCCATGGCGAACTCGGGAGCCATGT
AACCATATGTTCCAACAACCCTTCGAGTCACTGCTTCCGTCTCATTCTGTTTGAAAGTTCTTGCCAGACCAAAATCAGCTATCTTAGGATTCATG
TTTTCATCCAAGAGCACATTACTGGCCTTTAGATCTCTATGTATCAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E550079] SGN-U581100 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350954 [Download] [View] Facility Assigned ID: AGT-259_A07_TUS05#2-A19.Td_051
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0038 Quality Trim Threshold: 14.5