EST details — SGN-E550114

Search information 
Request: 550114Match: SGN-E550114
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C328590Clone name: TUS-5-E32
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C328590 [TUS-5-E32] Trace: SGN-T351189 EST: SGN-E550314 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E550114Length: 715 bp (792 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E550114 [] (trimmed) GAGAATTATACAACAATATTCAGAATTGTAGCAAGTAGCTAGAAAATACATATTAAACATCATGTGATGTTAAATATAAAAAAGATTGAGGACCT
AAAATACTCCTCATTCATCCTCAGACCATTACTTCAATTCCCACATCACAACAAAATACACACTTAAAAACAGACTTTTCACATGATACTACAAC
TACTAGGATTCTCATCACTAAACATATGAGTATTAGTGGCAGATTGATCAGCATTAGCAGCAGCAGCAGCAGCAGAAGTGTAGTAATAAGGATCA
GCATAAGTAGTGTAAGGGACTTGGCCATAGTTATTGTTGGTATTGTTATAGTAATAACCGGTGGAAGGAGGAACGAATGGTGAACGATTGTACAT
CATCTGAGGTTGTTGTTGTTGATGTTGCATAGCATGCCTGTTTTGAAAATTCATTAGCATTTGTGCTGGATTGTACTGTTGTTGTTGGCCTCCGT
TGTTCATGTTCATTAGCATCGAGGCAGAGGAAGGATGATGATGACCACCGGTGGATAAAGATCCCGGTATAGCATTGTTTTGATGACCTTGAAAT
CCACCCGCGTTCAAGAATGCAGCAACGTTGTTGTTATTGTTAGTAGTAGTAGTAGTAGTTCCATTGTTGTTATTCCCATGAAAACCAGCAAGATT
CATCATTGAGTTTAAGTCGTTTCCTCCCACCATTNCCATTTTCGCAGCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E550114] SGN-U567519 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T350989 [Download] [View] Facility Assigned ID: AGT-259_E08_TUS05#2-E20.Td_065
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0110 Quality Trim Threshold: 14.5