EST details — SGN-E550154

Search information 
Request: 550154Match: SGN-E550154
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C169211Clone name: TUS-5-C1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C16139 [cLED-15-F17] Trace: SGN-T52390 EST: SGN-E235817 Direction: 5' Facility: TIGR
Clone: SGN-C169211 [TUS-5-C1] Trace: SGN-T351281 EST: SGN-E550406 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E550154Length: 602 bp (762 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E550154 [] (trimmed) GCGGCCGCTCTATTACAGTGGATCGAAGGGCTGCAGGAATTCTCCACGAGGCAATGTTACGAAGGCTATACTGGAGGCCCTTGTTATCATGATAA
TTGGTACGGAAGACCAGTACAACCACCTCCACCACCACCATGCTACGACACATATTCATACGGATATGGGCCCGGGCCCGGGCCCATACCCTATG
GACTCCCAAAGGGATGTTATGTGAACAAATGTGATTACTTTAGTGAAGAGAATGCATCTGGATGCTCAATTATGTGAATCTAACATGTTGGGCCA
TACTAGGGCCCTTTTTACATTTTAATTGGGCCTTTTCACCAAAAGTCCAAATCAAACTTTGGATCTATATGGCTATCTTTTTGTATGTCATTATT
ATAGATTTATTACTTATAGAAAATAAATATATAAGTTACTTACTTTTACAAGAAAATTTGATTAAGAGAGAATAATTTGGTTACCAGATTACTGG
TTAACCGTCTTGTTACATAATTACTTTAAAAGTTTATTAATAAAAAGCACTTTGTTTATTAATTTGGTGCTAAGAAAGTTGTTGATTAATGTAGA
AATAAATTAATACATTAATTTTTTCTCTTCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E550154] SGN-U578859 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T351029 [Download] [View] Facility Assigned ID: AGT-257_C01_TUS05#1-C1.T3_004
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5