EST details — SGN-E550169

Search information 
Request: 550169Match: SGN-E550169
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C169245Clone name: TUS-5-D11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E550169Length: 657 bp (801 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E550169 [] (trimmed) CTGCAGGAATTCTTCACCAGGCTGCGCTCTTACATTTACACCGTTCGAGGACCCAGTATGCACAAAAGATGGCAATGTTTTTGAAATAATGCATA
TAGTTCCATACATCAGGAAATATGGGAGGAATCCAGTAACTGGGGCACCTATGAAGCAAGAAGACTTAATTCCTCTTACTTTCCACAAGAACTCT
GAAGGAGAGTATCATTGTCCGGTCTTGAACAAGGTTTTTACAGAGTTCACACATATAGTTGCTGTAAGAACTACGGGAAATGTTTTCTGTTATGA
GGCAGTTAAAGAACTGAATATCAAAACAAAGAACTGGAAGGAGCTTCTCACTGATGAAGCATTCTCTAGAGAAGACCTTATAACAATTCAAAATC
CTAATGCACTGGACACCAAGGTGCTTCTAGATTTTGATCATGTTAAGAAAAATTTAAAGGTTGACGATGAAGAAATACAGAAAATGCATTCTGAC
CCAACATACAACATAAATATTACTGGGGACATCAAGCAAATGCTCAAGGAACTTGGAAGTGAGAAAGCGAAAGAGATTGCACTGCATGGTGGAGG
TGGGAACAAGGCACAGAATGAAAGAGCTGCTGCTCTTGAGGCTATTTTAGCTGCAAGATCACGTATNCAAGATGACGCGAAAAACAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E550169] SGN-U570476 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T351044 [Download] [View] Facility Assigned ID: AGT-257_D11_TUS05#1-D11.T3_080
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0092 Quality Trim Threshold: 14.5