EST details — SGN-E550314

Search information 
Request: 550314Match: SGN-E550314
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C328590Clone name: TUS-5-E32
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C328590 [TUS-5-E32] Trace: SGN-T350989 EST: SGN-E550114 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E550314Length: 757 bp (793 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E550314 [] (trimmed) GCTCTTTTCAGTGGATCGACAGGCTGCAGGAATTTCCACGAGGTCAACCTCAACGAGGCTGCGAAAATTGGAATGGTGGGAGGAAACGACTTAAA
CTCAATGATGAATCTTGCTGGTTTTCATGGGAATAACAACAATGGAACTACTACTACTACTACTAACAATAACAACAACGTTGCTGCATTCTTGA
ACGCGGGTGGATTTCAAGGTCATCAAAACAATGCTATACCGGGATCTTTATCCACCGGTGGTCATCATCATCCTTCCTCTGCCTCGATGCTAATG
AACATGAACAACGGAGGCCAACAACAACAGTACAATCCAGCACAAATGCTAATGAATTTTCAAAACAGGCATGCTATGCAACATCAACAACAACA
ACCTCAGATGATGTACAATCGTTCACCATTCGTTCCTCCTTCCACCGGTTATTACTATAACAATACCAACAATAACTATGGCCAAGTCCCTTACA
CTACTTATGCTGATCCTTATTACTACACTTCTGCTGCTGCTGCTGCTGCTAATGCTGATCAATCTGCCACTAATACTCATATGTTTAGTGATGAG
AATCCTAGTAGTTGTAGTATCATGTGAAAAGTCTGTTTTTAAGTGTGTATTTTGTTGTGATGTGGGAATTGAAGTAATGGTCTGAGGATGAATGA
GGAGTATTTTAGGTCCTCAATCTTTTTTATATTTAACATCACATGATGTTTAATATGTATTTTCTAGCTACTTGCTACAATTCTATATATTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E550314] SGN-U567519 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T351189 [Download] [View] Facility Assigned ID: AGT-259_E08_TUS05#2-E20.T3_065
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0052 Quality Trim Threshold: 20.5