EST details — SGN-E550381

Search information 
Request: 550381Match: SGN-E550381
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C169503Clone name: TUS-5-O5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C169503 [TUS-5-O5] Trace: SGN-T350879 EST: SGN-E550004 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E550381Length: 536 bp (790 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E550381 [] (trimmed) CCCCTGAAATCCCATCTCTTTTTTTGAGACCAGGGAAAAAAGAAGTACAAGAAGAAGAAGTAGAAGAATTGAACTCAGAAATGTTTTCAACTAAG
TACTCTTCGACTAATTCTTTAACAGAACTCGCAGATAATGGATGAAAATGGGCACCCCATTCTAAAACAAAACTTTTAACCAAATCCCATTGTTC
CTCCTCACTGAACTTCTTCCATTTCTTCTTCATTTCCTCCGATTTCAATCCCGTGTAGTGGCAAAACTCAACGAACAAAAGCTCTTTGCTTTTCT
TCAACGCTTCCTCTTTCTGTATCATCTGGGTGTTCATCTTTCCAACCTCTGTTGCAAAATCTGATGCCAGGTCAATATCGTTCATGTCGTCGTCG
TTGTTGGTGCACGAGACTTTGTGAAACTTGGGATGATTCTTGAAGGTATACATCGAAGGGACCAAATTGGTTTGGGAGTTTGTGAATTGTGAAGG
GAAACGATTTGGATAAAGAAGATGAATTGTCAAAGCCATGGAAGGAGGATTGGCGTTGCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E550381] SGN-U581176 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T351256 [Download] [View] Facility Assigned ID: AGT-276_G05_TUS5#3-G5.Td_038
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0072 Quality Trim Threshold: 14.5