EST details — SGN-E550382

Search information 
Request: 550382Match: SGN-E550382
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C169506Clone name: TUS-5-O8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C18244 [cLED-22-J20] Trace: SGN-T54340 EST: SGN-E238274 Direction: 5' Facility: TIGR
Clone: SGN-C169506 [TUS-5-O8] Trace: SGN-T350901 EST: SGN-E550026 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E550382Length: 757 bp (795 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E550382 [] (trimmed) ATCACAAATGAAAACAATCCATGTACCAACCCAACAACTTACAAATAGCAAATCAAATAGTAAAAAGCAGTAAACATAAATAAAATCAACAAAGC
AAAAGGGAAATACAAAATGGTCACAACGTGGCACTGCCTCTATCCTGGCTAAGCTTATTAAATAGTGACAAAATAACTAAATATTGCAACCACAC
CGGAAATTAACAAGGGAATAAATGGTGACAAAGTAACTGATGCAGATGGATGTGTAGTATTAGTAGTTTCAGTCTTAGGAGCGGTGGTCCCGGTT
GTTGGTGTGGTGGTGCCGGTTGATGGTGTGGTAGCACCACCACTTCCTCCGGCTGCTGCCACGGTGACGGCTAGCTTCATGCCGCCGCTGCAGTG
GCCCATTACGCCGCAAATGAAGTAATGAGTGCCGGCGGTCTTGAGAGGGATAGTGGTGGCGCCGCTACTGTCGGACGTTATGGAATTACCGGTAG
TGCATGAAGAGTAGTCACTAGAACTTACTTCATCTACCGTGTGACCACTTGGATAGTTGAAAACTACAAAAATATTACGTGTTTAATTTATATAC
ATAACGTAAAAGATACTCTTTTTATCTCAAATTACTTGACATATAAACTTATGTAGCAGAAAGAATACTATTTTTCTATATTTAAAAGCAATTTA
ATTAACTTCAAATTTTTCATTTTATCTCCGCGAAGAATTTATAGCTTTTTATGCATTATCTCAACGACGTTCAGAAAATGGCGAATTTCTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E550382] SGN-U583177 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T351257 [Download] [View] Facility Assigned ID: AGT-276_G08_TUS5#3-G8.Td_066
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0049 Quality Trim Threshold: 20.5