Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E550406

Search information 
Request: 550406Match: SGN-E550406
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C169211Clone name: TUS-5-C1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C16139 [cLED-15-F17] Trace: SGN-T52390 EST: SGN-E235817 Direction: 5' Facility: TIGR
Clone: SGN-C169211 [TUS-5-C1] Trace: SGN-T351029 EST: SGN-E550154 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E550406Length: 520 bp (786 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E550406 [] (trimmed) TTTCTACATTAATCATCACTTTCTTAGAACAAATTAATAAACAACGTGCTTTTTATTAATAAACTTTTAAAGTAATTATGTAACAAGACGGTTAA
CCAGTAATCTGGTAACCAAATTATTCTCTCTTAATCAAATTTTCTTGTAAAAGTAAGTAACTTATATATTTATTTTCTATAAGTAATAAATCTAT
AATAATGACATACAAAAAGATAGCCATATAGATCCAAAGTTTGATTTGGACTTTTGGTGAAAAGGCCCAATTAAAATGTAAAAAGGGCCCTAGTA
TGGCCCAACATGTTAGATTCACATAATTGAGCATCCAGATGCATTCTCTTCACTAAAGTAATCACATTTGTTCACATAACATCCCTTTGGGAGTC
CATAGGGTATGGGCCCGGGCCCGGGCCCATATCCGTATGAATATGTGTCGTAGCATGGTGGTGGTGGAGGTGGTTGTACTGGTCTTCCGTACCAA
TTATCATGATAACAAGGGCCTCCAGTATAGCCTTCGTAACATTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E550406] SGN-U578859 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T351281 [Download] [View] Facility Assigned ID: AGT-258_C01_TUS05#1-C1.Td_004
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0051 Quality Trim Threshold: 14.5