Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E550434

Search information 
Request: 550434Match: SGN-E550434
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C169307Clone name: TUS-5-G1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C16294 [cLED-15-P5] Trace: SGN-T52273 EST: SGN-E235700 Direction: 5' Facility: TIGR
Clone: SGN-C169307 [TUS-5-G1] Trace: SGN-T350941 EST: SGN-E550066 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E550434Length: 685 bp (787 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E550434 [] (trimmed) GACAGGAATCTGATGAGGAAAGCTTATAACAGTGAAACAATTGAGCATATAGAACAGTAAGTAATCACTAAATGGAGTAACAAAGAAATATCAAT
GTGTAACAGAAGAAGACCCTATTTCACTCATTGGTGGTGTGAGGTTTGGTGTAGAAGCTTCCGTGGATGGTCGAGTCCCCGTATTCACTCTCCTA
ACACCCTCTACCATCTTTACTACTTCTGTCATTTTTGGTCTCTGCTCTGGCATTCTGGATACACAAGTCAAACCTATTTGTAACATCTCCACCAT
TTCTTCTTCTATATTTGGATACCTCAAAAGCTCCACGTCGAATACTTCAGCAGTCCACTCCTCTCGAACGACAGAATGTACCCACCTGACTAAGT
GGACAATGTCGCTAGTACCTGTGGCATGTGTAGGGGACTTTCCAGTGAGAAGTTCTAGTATTAGGACGCCAAAGCTGTAGACATCAGTGGCTTGA
GATACTTTTCTTGAATCTGTAACTTCTGAGGGGTTGATGACCAGCAGCTCGCACGATTGGTATAGCAATTGGACCCATTATAGTTGCCAAGCCAA
GATCAGAAATACAACCGAAACCTTGGGAGTTGAGGAATATGTTTGAGGATTTTATGTTCCCGTGGACAAGCCTTCCCCCAGACTGTCCATGTATT
TTGAGCATGCCTCTAGCTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E550434] SGN-U582034 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T351309 [Download] [View] Facility Assigned ID: AGT-258_G01_TUS05#1-G1.Td_006
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0100 Quality Trim Threshold: 20.5