EST details — SGN-E550454

Search information 
Request: 550454Match: SGN-E550454
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C328577Clone name: TUS-5-D28
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C328577 [TUS-5-D28] Trace: SGN-T350979 EST: SGN-E550104 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E550454Length: 674 bp (747 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E550454 [] (trimmed) GGTTGTGAAGGTATGTGATTTTGGACTGTCAAGAATGAAGCACAGCACATTTCTTTCTTCTAGGTCTACTGCTGGGACGGCAGAGTGGATGGCCC
CAGAAGTGCTGAGAAATGAACCTTCAAATGAAAAATGTGATGTATATAGCTTCGGTGTCATACTATGGGAGCTCTGTACTTTACAGCAACCATGG
GGAGGAATGAATCCAATGCAAGTCGTTGGCGCTGTGGGGTTTCAGCACCGTCGTCTTGACATACCAGATGACACGGATCCAGCTATTGCAGACAT
TATCAGGAAATGCTGGCAAACAGATCCAAAGTTACGGCCTTCATTTACTGAGATAATGGCTGCTCTGAAACCACTACAAAAGCCTATTACTAGTT
CACATGCACCAAAACCACCAGTTGCCAGAGGCCAACCATCGTGAATCTTAGAAGATGCATCCGCGGAGCAGGGTTAATACTGAAGAACGTAAATA
GACGTATTTTTCGTTGAATTTAAACAGGTCCGAATTTGAGCTCAAGAAGCTGAAAGAAGACATCAAAGAACCTGACAGTCAGATACTTCATTTTA
AGCCAAATTGTGATTCTTTTGTTAGCAGTGTTTCCCTAGTNCCTCAAAATTGTGTATCTGCCTTCCCTTGTGTATTCATATTGATTCCCTCTTTT
GTAATTAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E550454] SGN-U581044 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T351329 [Download] [View] Facility Assigned ID: AGT-259_D04_TUS05#2-D16.T3_032
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0058 Quality Trim Threshold: 14.5