EST details — SGN-E550470

Search information 
Request: 550470Match: SGN-E550470
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C169371Clone name: TUS-5-I17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C16495 [cLED-16-L12] Trace: SGN-T52656 EST: SGN-E236083 Direction: 5' Facility: TIGR
Clone: SGN-C169371 [TUS-5-I17] Trace: SGN-T351351 EST: SGN-E550476 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E550470Length: 718 bp (796 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E550470 [] (trimmed) AAATCACTTTCTCAGACGTCTTCCGTGTTTTCTTTTCTCTGACGACGCGCAGCTATAGGAATTTCCCAGTCAAGCTCATTGGCTCCAGATTCAAG
CAAGGCCAAGAGTGCAGCTGCTTCCGTATTTGCTATTCTAGACAGGAAATCAAAAATAGATCCAAGTGATGAATCTGGTATGACACTGGACACAG
TGAAGGGAGATATTGAGCTGAAGCACGTAAGCTTTAAGTATCCGACAAGGCCAGATGTTCAAATTTTAAGAGACCTTTGTTTGACCATTCGCAGT
GGAAAGACGGTTGCTTTGGTTGGGGAGAGCGGATGTGGAAAGTCTACCGTAATATCATTGCTGCAAAGGTTTTATGATCCTGATTCAGGCCAGAT
TTCGTTGGACGGAATAGAAATTCAGAAGTTCCAGGTAAAATGGCTAAGGCAGCAAATGGGGCTTGTAAGCCAAGAGCCTGTGTTGTTCAACGACA
CAATTCGAGCCAATATTGCCTATGGAAAGGAAGGAAATGCAACAGAAGCAGAAGTTTTAGCAGCAGCCGAATTAGCAAACGCCCACAAGTTCATC
AGTGGTCTGCAACAGAGTTATGATACGACAGTGGGAGAACGAGGAACTCAACTGTCAGGTGGGCAGAAGCAACGAGTAGCTATAGCGAGGGCCAT
ATTGAAAAATCCAAAATCCTACTATTAGATGAGGCGACNAGCGCATTGGATGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E550470] SGN-U584047 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T351345 [Download] [View] Facility Assigned ID: AGT-277_A05_TUS5#4-A5.T3_035
Submitter: Koni Sequencing Facility: Avesthagen
Funding Organization: Italian Ministry of Agriculture and Forestry (MiPAF)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0099 Quality Trim Threshold: 14.5