EST details — SGN-E550676

Search information 
Request: 550676Match: SGN-E550676
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C171831Clone name: TUS-11-P5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C63221 [cLEM-24-L5] Trace: SGN-T87477 EST: SGN-E273271 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E550676Length: 610 bp (701 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E550676 [] (trimmed) TCTTGGGGGTCTTTTTACACGCTTGAAACCCCCTCAAAGCCCATATAGGTTTCCTAGAAAATCTGAGCTTCCTTTTGAGATTGAGTTGATTGAAT
TCTCCAAAGTGAAGGTGATCACTGATGAGGTGGGGGGGGTAAAGAAGGTTATAGAAGAAGGACAAAGCTGGGAAACACCACGGGAACCTTATGAA
GTAAAAGCTTGGATTTCGGCGAAGTCAGCAGATGGCAAAGTGATTCTATCGTGGACCAAGGATGAACCATATTTCTTCACATTTGGTAAACCTGA
GGTACCCAAAGGTCTTGAACTGGCGATAGCAACCATGCCACGTGGAGAGAAAGCAGTCATTTATGTTAAAAGCCAATATTATACAGAATCTACTT
TAATGCCTGTGGTAGAAGGTGTTGACGAAGTCCATTTTGAGGTGGAACTTGTTCATTTTATTCAGGTGCGAGATGTGCTTGGAGACGGACGCCTC
ATAAAACGCCGAATACGTGATGGAAGAGGTGAATTTCCTATGGATTGCCCTCTGCAAGACAGTCTACTGCGTGTACACTACAAAGGTTTGCTTCT
TAATGAAGAAAAGACGGTGTTCTATGATACAAGAATCGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E550676] SGN-U583859 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T351551 [Download] [View] Facility Assigned ID: TUS11P5_T3
Submitter: Koni Sequencing Facility: Giovanni
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0065 Quality Trim Threshold: 20.5