Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E550798

Search information 
Request: 550798Match: SGN-E550798
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C186709Clone name: TUS-50-L3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C8729 [cLEC-52-P16] Trace: SGN-T32629 EST: SGN-E209820 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E550798Length: 619 bp (731 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E550798 [] (trimmed) CTTTTCAGGGTTGTTGATAAGGAAAAAGCACACCATGGCTTTGGCCATTGCTACATTCCTCTTCATCACTCTTCTTTCAACAACAAAAACTTTAG
CTTTTGATTCATGTCCATCTAATGAACAACTTTCAGTCATCCCCATTTATGGCAAATGCTCACCTTTCAACACACCAAAACCTACTTCTTGGGAA
AACACACTTATCAACATGGCCTCTAAAGATCCACAAAGACTTTCTTATTTGTCTAGTTTAGTAGCCCAAAAGCCTAATTCAGCCCCTATTGCTTC
AGGCCAACAAGTATTCAACATTGGTAACTATGTTGTTCGGGCTAAAATCGGTACCCCGGGCCAGCTAATGTTTATGGTCCTGGATACCAGTAGTG
ACACTGCATGGGTTCCATGCAGTGGCTGTACTGGCTGTACCTCTAGTGTATTTACTCCCAATATCTCGTCGACTTATGGGTCGATGGGTTGCTCT
GTACCCGAATGCACACAGGTTAAGGGGCAATCTTGCCCCGCTGCTGGTGCACCGGGTGCTTGTTTTTTCAACCAATCCTATGGTGGAGCTTCGTC
GTTCTACGCCACGCTGTCACGTGATTCACTTAGACTAGGTGCTGATGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E550798] SGN-U564367 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T351673 [Download] [View] Facility Assigned ID: TUS50L3_T3
Submitter: Koni Sequencing Facility: Giovanni
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0016 Quality Trim Threshold: 14.5