Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E550814

Search information 
Request: 550814Match: SGN-E550814
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C186768Clone name: TUS-50-N14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
See unigene SGN-U565313 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C9677 [cLEC-66-K2] Trace: SGN-T33481 EST: SGN-E211945 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E550814Length: 644 bp (785 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E550814 [] (trimmed) CTTAACAGTGTGCTATTCTGGTCCGTCTTTGTGAGTTGCTTCGTGGAAAACAAAATGGTTTCTGTTGAAAGATTAAAACAGTTCTCATGCATACC
ATCAGAAGCTGAGTGGCGAAAAAGGGATTTTGTCCCACCTTCAGATTGGCCGAACCATGGCAATGTTGAGCTTGAAGACTTACAAGTTAGGTATC
GTCCAAATACTCCTCTAGTGCTTAAAGGAATTACTCTCAACATTAGAGGGGGAGAGAAGATCGGTGTTGTTGGTCGTACTGGAGGTGGAAAATCA
ACACTTATTCAAGTTTTCTTCCGTTTGGTGGAGCCTGCAGCTGGAAGAATAGTCATTGACGGCATTGACATATCCAGGCTCGGGCTTCATGATCT
TAGATCTCGCTTTGGGATCATTCCTCAAGAACCAGTTCTTTTTGAAGGAACTGTGAGAAGCAACATTGACCCCATTGGACAATATTCAGATGATG
AAATTTGGAAGAGCCTCGATCGCTGCCAACTGAAAGAAGTGGTGTCTTCAAAACCCGAAAAGCTTGACTCACCAGTTGTTGATAATGGAGACAAC
TGGAGTGTTGGGCAGAGGCAGCTTCTTTGCTTANGAAGAGTGATGCTAAAACGAAGCAGACTTCTATTTATGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E550814] SGN-U565313 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T351689 [Download] [View] Facility Assigned ID: TUS50N14_T3
Submitter: Koni Sequencing Facility: Giovanni
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0072 Quality Trim Threshold: 14.5