EST details — SGN-E550826

Search information 
Request: 550826Match: SGN-E550826
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C186794Clone name: TUS-50-O16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C9893 [cLEC-67-E18] Trace: SGN-T33822 EST: SGN-E211596 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E550826Length: 625 bp (754 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E550826 [] (trimmed) GGTCTTTTAACACGCTTGAAACCCCCACAAGGTCCAAGGGAGTTTCAGTATCAAATTTGAAATGTTGGATTGTATAAAGGAGTGTCAGAACACGG
TATTTCAGTTTCAACATATCTCTAGGTAGCAATGAAGCTATCCGTCGCTAATTCTACCCCCTCTTCCATCCCAAAGAAGATTAAAAGAAGTAAAT
AGCCTAATTATAGTGTCTCATTAGATAGTATAATCCACATGTAGAAAATGAAGAAAATCATATCTTTTTCTTCCAGCTTCCCCATTAAAAGTCAA
TAAACAACATAAAGAGGTTATGCATCCTGATGTCCTTTCAGCTTTTGTATTTCATGCTTGCTTTTATTGATGCAGCTGTGATGTGTAAAGTTTTC
TGAGTGAATACTCTGGAATAGATGAGGGAGACTGAAGGAGCACTGACATCTTCTACTACTTGTTTTCGTATAGATTTAAACAGCTTGGTCCTCGA
CATTACTTGCATCTTTTCCCCCTGTAAAATGTTTTTTTTTGGTGATTTTTTAATTTTTCTGTGATGTCTAAATTGCGATGTGTCTCTACATCACT
CCTTTTGGTGTCTACAGATTGCTTTTACAGGGTCCACAGAAACTGGTAAAGCTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E550826] SGN-U584013 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T351701 [Download] [View] Facility Assigned ID: TUS50O16_T3
Submitter: Koni Sequencing Facility: Giovanni
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0015 Quality Trim Threshold: 20.5