EST details — SGN-E550842

Search information 
Request: 550842Match: SGN-E550842
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C186808Clone name: TUS-50-P6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C10033 [cLEC-67-L10] Trace: SGN-T33751 EST: SGN-E211525 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E550842Length: 626 bp (726 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E550842 [] (trimmed) TAGTGGATCCTCCAAGATGCAGGAATTCCGCACGAGGGCTGGTGCGGCGTCCTATTTGCTATTGTATATGCTTGCTAGTCATATAGTTGGGTCTT
TTTGGTACTTGCTAGCTGTGGAACGCTATGATACATGCTGGCAGCAAGCTTGTAAACACAATGCAACGTGCAACACTGATTTCTTGTACTGTGGG
AATCAGTACATGACGGGTTATAATAGATGGAGCAGCATAAGTGAATCAGTTTTAAACAATGCTTGCCCTGCAGATAGTGACAACTCACCATTTGA
TTTCGGGATTTTTGATCAGGCTTTATCGTCTGGCATCATTTATTCCATGAAATTCGTGGCTAAATATTGTTATTGTCTGTGGTGGGGGCTGCAGA
ACTTAAGTACCCTCGGACAGGGACTTCAAACTAGCACATATCCCGGGGAGTCTATTTTCTCTATAGGATTGGCTATACTTGGGCTCATTCTCTTT
GCATTATTGATTGGTAACATGCAGACGTATCTACAATCTCTTACCATTCGACTAGAAGAGATGAGAGTTAAAAGGCGTGACTCAGAACAGTGGAT
GCATCATCGGTTACTCCCACAAGATCTCCGGGAACGGGTTAGGCGCTATGATCAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E550842] SGN-U571287 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T351717 [Download] [View] Facility Assigned ID: TUS50P6_T3
Submitter: Koni Sequencing Facility: Giovanni
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0014 Quality Trim Threshold: 14.5