EST details — SGN-E550880

Search information 
Request: 550880Match: SGN-E550880
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C188033Clone name: TUS-54-C7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C31059 [cLEG-11-N19] Trace: SGN-T65979 EST: SGN-E250196 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E550880Length: 501 bp (638 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E550880 [] (trimmed) AACAAATTAATTTTCTTCTTAACCAATTTCCGGAGCCTTTTTCTAAATTCATATCAGGTTTGTAAGGTTTTTGGGAATGGATGAGGTCAAGAAAT
CCAGGGTCATATGACATCCCCTGCAACTTTTGTGAAAGGAGGAATTCAGGATGCATGTGATGATGCTTGCATCATTTGTCTCGAGGATTTCTGCA
AAAGCGAGCCTCCCTCGGTAACTAGCTGCAAGCATGAGTTTCATCTCCAGAGCGTCCTGGAATGGTGACAGAGAACTTCTAATTGTCCTATGTGT
TGACAGTCCATAAGTCTGAAAGATCAGATGAGTCAAGAATTGTTTGAAGCTGTGGAACAACAAAGGAATTTTATAGTTAATGCACAAAGAAATGC
TACCGTATTTCAGTTTCCTGCACTGGGAGATTTTGAACTACAGCATGTGTGTGGCTGCCTTAAAGGATAAGCATTTTCGTTTTTCATCTGATTTC
TGAGTTTCACAAGCTAGCATGTTCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E550880] SGN-U583321 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T351755 [Download] [View] Facility Assigned ID: TUS54C7_T3
Submitter: Koni Sequencing Facility: Giovanni
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0295 Quality Trim Threshold: 14.5