EST details — SGN-E550914

Search information 
Request: 550914Match: SGN-E550914
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C188114Clone name: TUS-54-F16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C32984 [cLEG-24-N20] Trace: SGN-T67718 EST: SGN-E253470 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E550914Length: 530 bp (659 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E550914 [] (trimmed) GGATGGTACCATCAGAGTGTGGAATATTAATGTACGTTATCACCTTTCTGAGGACCCCAAGACATTAAAGGTGTTCCCTATTCCCCTTAAGGATG
CAAGTGGCACAACTTTACACTATGATCGTTTATGTGTATCACCTGATGGAAAGATATTGGCCACCACTCATGGTTCAATGATGCAATGGCTATGT
ATGGAGACTGGGAAGGTTCTGGAAACAGCTGAAAAAGCACATGATGGTGATATCACGGACATGGCATGGTCGCCTTCTCCAATTCCAATGGGTGA
CAAGAAAGTTCTGGTGTTGGCCACAGCCAGTGTCGATAAGAAAGTGAAGTTGTGGGCAGCTCCATCCCTGAATGCATCATGAATGACAAGTATTT
GATGTCTCGCCTAGTTTTTTGAACGAATAGATCAGAAGAGGAGAATACAGCCGAAGTTCGAGGATTGAGTGCTTACATCTTTTAAGGGCTTTGTT
ATTTAAAGAGAGACTTAACCAGAATGTGGTGAAGCTAGAGAAAAATTTTGATGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E550914] SGN-U573516 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T351789 [Download] [View] Facility Assigned ID: TUS54F16_T3
Submitter: Koni Sequencing Facility: Giovanni
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0023 Quality Trim Threshold: 14.5