Notice: The contact form functionality has been restored. Apologies for any inconvenience.

EST details — SGN-E550939

Search information 
Request: 550939Match: SGN-E550939
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C188160Clone name: TUS-54-H14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C34614 [cLEG-31-I9] Trace: SGN-T69325 EST: SGN-E255032 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E550939Length: 511 bp (672 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E550939 [] (trimmed) AAACATAATTTTCTCTGAAGGTTCTCGCGCGTTCAAAATAATTGATCTTGGTGCTGCAGCAGATTTGAGAGTAGGAATCAATTATATTCCTAAGG
AGTTTCTTTTAGATCCAAGATACGCTGCACCAGAGCAATACATTATGAGCACACAAACCCCTTCCGCACCGTCTGCTCCAGTTGCAACTGCACTG
TCCCCAGTACTCTGGCAGCTGAATCTCCCAGATCGATTTGACATCTACAGTGTCGGTCTCATATTCCTGCAAATGGCATTCCCAGGATTACGCAG
TGACAACAGTCTCATTCAATTCAACCGACAACTGAAGAGATGCGACTATGATTTAGTTTCGTGGAGACAGAGTGTAGAGCCTCGTGCTGGCCCTG
AACTTAGGAAAGGCTTCGAGTTGTTAGATTTGGATGGTGGAATAGGGTGGGAGCTATTAACATCTATGGTACGTTTCAAAGCACGCCAAAGAATT
AGTGCAAAGACAGCTTTAGCACATCCATACTTTGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E550939] SGN-U567573 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T351814 [Download] [View] Facility Assigned ID: TUS54H14_T3
Submitter: Koni Sequencing Facility: Giovanni
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.987 Expected Error Rate: 0.0035 Quality Trim Threshold: 14.5