EST details — SGN-E550963

Search information 
Request: 550963Match: SGN-E550963
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C188208Clone name: TUS-54-J14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C36036 [cLEG-37-F5] Trace: SGN-T70716 EST: SGN-E256232 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E550963Length: 246 bp (678 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E550963 [] (trimmed) TGGAATGCACAAGGAACAACAGTCGGACACTATAATCACAATTATTAGAAGCCACATCACCTCTAGTACTAGATACAGTTAAATATGTGACAGGA
CAATTTCCTCTAGAATGACTTTTGGTAACAAAGTTTAGCTACACATGATTATTGTAAACTGTTTACATTACCAATATTACAAGTCTTCAGAAGGC
ACCTCTTCTGGATTGATCCCGACATCAGGCATTGATAACTCTGTTTGATTGTCACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E550963] SGN-U562775 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T351838 [Download] [View] Facility Assigned ID: TUS54J14_T3
Submitter: Koni Sequencing Facility: Giovanni
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.909 Expected Error Rate: 0.0314 Quality Trim Threshold: 12.5